View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14258_low_40 (Length: 238)
Name: NF14258_low_40
Description: NF14258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14258_low_40 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0028 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 123431 - 123209
Alignment:
| Q |
1 |
ttgaggtttctatttattgatttttatattatagtcttaatctattatccacaacttttggaataacacttgcaattaggctggtgtcacaaatcctttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123431 |
ttgaggtttctatttattgatttttatattatagtcttaatttattatccacaacttttggaataacacttgcaattaggctggtgtcacaaatcctttg |
123332 |
T |
 |
| Q |
101 |
gaatatccaattcttctggaccgattggaaaatagaaagttggtttgtaaagttaagtggcagccatcttgggacagttgttcagttcaagcagtcaagg |
200 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123331 |
gaatatccaattcatctggaccaattggaaaatagaaagttggtttgtaaagttaagtggcagccatcttgggacagttgttcagttcaagcagtcaagg |
123232 |
T |
 |
| Q |
201 |
aagatgaaggtttgatagaaaag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
123231 |
aagatgaaggtttgatagaaaag |
123209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 70 - 216
Target Start/End: Complemental strand, 23697143 - 23696997
Alignment:
| Q |
70 |
ttgcaattaggctggtgtcacaaatcctttggaatatccaattcttctggaccgattggaaaatagaaagttggtttgtaaagttaagtggcagccatct |
169 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||| || |||||| ||||||||| ||||| | || |||||||| |||||||||||| || |
|
|
| T |
23697143 |
ttgcatttaggctggtgtcacaaatccattggaatatccaatactactggactaattggaaaaaagaaatgtcgtctgtaaagtgaagtggcagccaact |
23697044 |
T |
 |
| Q |
170 |
tgggacagttgttcagttcaagcagtcaaggaagatgaaggtttgat |
216 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
23697043 |
tgggacagttgttcagtgcaagcaatcaaggaggatgaaggtttgat |
23696997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 77 - 223
Target Start/End: Complemental strand, 22078130 - 22077985
Alignment:
| Q |
77 |
taggctggtgtcacaaatcctttggaatatccaattcttctggaccgattggaaaatagaaagttggtttgtaaagttaagtggcagccatcttgggaca |
176 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| | |||||| ||||||||| ||| |||| ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
22078130 |
taggctggtgtcacaaatcctctggaata-ccaacacacttggaccaattggaaaacagagagtttatttgtaaagttaaatggcagccaacttgggaca |
22078032 |
T |
 |
| Q |
177 |
gttgttcagttcaagcagtcaaggaagatgaaggtttgatagaaaag |
223 |
Q |
| |
|
| ||||| ||||||||| ||||||||||||||||||| || |||||| |
|
|
| T |
22078031 |
gctgttcggttcaagcaatcaaggaagatgaaggtttaattgaaaag |
22077985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University