View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14259_high_15 (Length: 365)
Name: NF14259_high_15
Description: NF14259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14259_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 98 - 343
Target Start/End: Complemental strand, 17977379 - 17977139
Alignment:
| Q |
98 |
tataactacaaacccgcaaggaaacaagaacaacaaaatactccaatagagagagaaacccgcaatgattctctcaaaaaataaataaacccgcaatgat |
197 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17977379 |
tatagctacaaacccgcaaggaaacaggaactacaaaata-----atagagagagaaacccgcaatgattctctcaaaaaataaataaacccgcaatgat |
17977285 |
T |
 |
| Q |
198 |
tagttggatatacgagtcactctcaaagtcggtgtcttacaaacctatttgcctatttatatcaaaagtctgaaaaccctaatcatatacattccttatt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17977284 |
tagttggatatacgagtcactctcaaagtcggtgtcttacaaacctatttgcctatttatatcaaaagtctgaaaaccctaatcatatacattccttatt |
17977185 |
T |
 |
| Q |
298 |
cgagtttctctcttactctctcccataacaaaccctctttctctcc |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17977184 |
cgagtttctctcttactctctcccataacaaaccctctttctctcc |
17977139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 246 - 317
Target Start/End: Original strand, 17913929 - 17913999
Alignment:
| Q |
246 |
ttgcctatttatatcaaaagtctgaaaaccctaatcatatacattccttattcgagtttctctcttactctc |
317 |
Q |
| |
|
||||| |||||||||||| | |||||||||||||||||||| |||||| |||| | ||||||||||||||| |
|
|
| T |
17913929 |
ttgcccatttatatcaaactt-tgaaaaccctaatcatataccttccttgttcgcgcttctctcttactctc |
17913999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University