View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14259_high_21 (Length: 283)

Name: NF14259_high_21
Description: NF14259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14259_high_21
NF14259_high_21
[»] chr2 (2 HSPs)
chr2 (176-268)||(32537823-32537915)
chr2 (223-265)||(32535199-32535241)


Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 176 - 268
Target Start/End: Complemental strand, 32537915 - 32537823
Alignment:
176 tgggactaaagtgtttattgaatagagccacgctaaagatgtgatgcaaatgttcagaagattagttaggaaatagaaaatgacctaactgat 268  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32537915 tgggactaaagtgtttattgaatagagccacgctaaagatgtgatgcaaatgttcagaagattagttaggaaatagaaaatgacctaactgat 32537823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 265
Target Start/End: Complemental strand, 32535241 - 32535199
Alignment:
223 aaatgttcagaagattagttaggaaatagaaaatgacctaact 265  Q
    ||||||| |||||||||||||||||||||||||||| ||||||    
32535241 aaatgttaagaagattagttaggaaatagaaaatgatctaact 32535199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University