View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14259_low_26 (Length: 283)
Name: NF14259_low_26
Description: NF14259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14259_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 176 - 268
Target Start/End: Complemental strand, 32537915 - 32537823
Alignment:
| Q |
176 |
tgggactaaagtgtttattgaatagagccacgctaaagatgtgatgcaaatgttcagaagattagttaggaaatagaaaatgacctaactgat |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32537915 |
tgggactaaagtgtttattgaatagagccacgctaaagatgtgatgcaaatgttcagaagattagttaggaaatagaaaatgacctaactgat |
32537823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 265
Target Start/End: Complemental strand, 32535241 - 32535199
Alignment:
| Q |
223 |
aaatgttcagaagattagttaggaaatagaaaatgacctaact |
265 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
32535241 |
aaatgttaagaagattagttaggaaatagaaaatgatctaact |
32535199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University