View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14259_low_29 (Length: 259)
Name: NF14259_low_29
Description: NF14259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14259_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 30 - 241
Target Start/End: Original strand, 33079292 - 33079494
Alignment:
| Q |
30 |
cgtaacgaatactgttacttttaatacacgagtggcattaaagctctcgttccttctttcttttaccccgcaaaccaacaaccatcatattcatcactca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33079292 |
cgtaacgaatactgttacttttaatacacgagtggcattaaagctctcgttccttctttcttttaccccgcaaaccaacaaccatcatattcatcactca |
33079391 |
T |
 |
| Q |
130 |
tcaatcggtac----cagattcttctcttttctcatttctcatttccttcataaaccagcaacacca-cccccttgcgcacgttagcacctcccccttcg |
224 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
33079392 |
tcaatcggtacgtaccagattc--------------ttctcatttccttcataaaccagcaacaacacccccctcgcgcacgttagcacctcccccttcg |
33079477 |
T |
 |
| Q |
225 |
tttctccgtcgtttatc |
241 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33079478 |
tttctccgtcgtttatc |
33079494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University