View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14259_low_30 (Length: 259)
Name: NF14259_low_30
Description: NF14259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14259_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 135 - 251
Target Start/End: Complemental strand, 31849250 - 31849132
Alignment:
| Q |
135 |
tgaattttgcaggacgacacattaccaaagctgaattttattaatgccttgtaaagatacatacatcttgaagacaagaaaccatctttatttgctta-- |
232 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31849250 |
tgaattattcaggacgacacattaccaaagctgaattttattaatgccttgtaaagatacatacatcttgaagacaagaaaccatctttatttgcttagt |
31849151 |
T |
 |
| Q |
233 |
gtgattctattcctatgct |
251 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31849150 |
gtgattctattcctatgct |
31849132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 31849335 - 31849250
Alignment:
| Q |
19 |
cattgggattatagactgacattattttgtagcttcatgtttttcaataaaaatacatataaactttttctttgggtgaatatcat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31849335 |
cattgggattatagactgacattattttgtagcttcatgtttttcaataaaaatacatataaactttttcattgggtgaatatcat |
31849250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 26 - 164
Target Start/End: Complemental strand, 11469329 - 11469191
Alignment:
| Q |
26 |
attatagactgacattattttgtagcttcatgtttttcaataaaaatacatataaactttttctttgggtgaatatcattttatgataacatgaattatt |
125 |
Q |
| |
|
||||||| | ||||| ||| |||| ||| || ||||||| |||||||||| | | ||||||||||||||| ||||||||||| |||||||| || ||||| |
|
|
| T |
11469329 |
attataggcagacataattctgtaacttgatttttttcagtaaaaatacaaacacactttttctttgggtcaatatcattttttgataacacgagttatt |
11469230 |
T |
 |
| Q |
126 |
caatcaagctgaattttgcaggacgacacattaccaaag |
164 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
11469229 |
aaatcaagctgaattttgcaggaggacgcattaccaaag |
11469191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University