View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14259_low_31 (Length: 252)
Name: NF14259_low_31
Description: NF14259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14259_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 25 - 235
Target Start/End: Original strand, 6005129 - 6005338
Alignment:
| Q |
25 |
gaagcaaaagtaaaacattggagaagtcatccatgacttttttaagagacacacttgctattaggatgcattatgaattctatttgcggttgcaatagag |
124 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6005129 |
gaagcaaaagtaaaacattggagaagtcgtccatgactttt-taagagacacgcttgctattaggatgcattatgaattctatttgcggttgcaatagag |
6005227 |
T |
|
| Q |
125 |
ggaagcttagaggatttgtccaaaactttgcaagatttaattttcggtttctgaagacaaagtctaagatttaaattcttgtatttgtcttggtatttga |
224 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6005228 |
ggaagcttaacggatttgtccaatactttgcaagatttaattttcggtttctgaagacaaagtctaagatttaaattcttgtatttgtcttggtatttga |
6005327 |
T |
|
| Q |
225 |
aagttctacat |
235 |
Q |
| |
|
||||||||||| |
|
|
| T |
6005328 |
aagttctacat |
6005338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University