View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14259_low_38 (Length: 225)
Name: NF14259_low_38
Description: NF14259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14259_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 30 - 184
Target Start/End: Complemental strand, 44466196 - 44466042
Alignment:
| Q |
30 |
ttataaaatctgtaaaataaagattttagatggcacgagaaaaatggaggttggnnnnnnnntcttatatgaaattttcaaaacaaaaccctcaatggcg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44466196 |
ttataaaatctgtaaaataaagattttagatggcacgagaaaaatggaggttggaaaaaaaatcttatatgaaattctcaaaacaaaaccctcaatggcg |
44466097 |
T |
 |
| Q |
130 |
caaatacgagacactttaaggctcaaacatgagacaaccatgtacgattttgaac |
184 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
44466096 |
caaacacgagacactttaaggcccaaacatgtgacaaccatgtacgattttgaac |
44466042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University