View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14261_low_3 (Length: 257)
Name: NF14261_low_3
Description: NF14261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14261_low_3 |
 |  |
|
| [»] scaffold0620 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0620 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: scaffold0620
Description:
Target: scaffold0620; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 15 - 165
Target Start/End: Complemental strand, 1292 - 1142
Alignment:
| Q |
15 |
aatatctcaagatttgatttagtaactaatttgttaaacgtgattcatcaaattagtctaatctaagttgacaaataatctcgttaataaatgagttgaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
1292 |
aatatctcaagatttgatttagtaactaatttgttaaacgtgattcatcaaattagtctaacctaaattgaccaataaactcgttaataaatgagttgaa |
1193 |
T |
 |
| Q |
115 |
cttgaattatgtattattcaattttttatgttatgagccaaatcaatatgt |
165 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1192 |
cttgaattatgcattattcaattttttatgttatgagccaaatcaatatgt |
1142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0620; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 203 - 257
Target Start/End: Complemental strand, 1139 - 1085
Alignment:
| Q |
203 |
taaaaagaatgatttattctcatgcaaatttcaaaggctttaaagtatgttcatt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1139 |
taaaaagaatgatttattctcatgcaaatttcaaaggttttaaagtatgttcatt |
1085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 15 - 165
Target Start/End: Complemental strand, 34087839 - 34087689
Alignment:
| Q |
15 |
aatatctcaagatttgatttagtaactaatttgttaaacgtgattcatcaaattagtctaatctaagttgacaaataatctcgttaataaatgagttgaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
34087839 |
aatatctcaagatttgatttagtaactaatttgttaaacgtgattcatcaaattagtctaacctaaattgaccaataaactcgttaataaatgagttgaa |
34087740 |
T |
 |
| Q |
115 |
cttgaattatgtattattcaattttttatgttatgagccaaatcaatatgt |
165 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34087739 |
cttgaattatgcattattcaattttttatgttatgagccaaatcaatatgt |
34087689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 203 - 257
Target Start/End: Complemental strand, 34087686 - 34087632
Alignment:
| Q |
203 |
taaaaagaatgatttattctcatgcaaatttcaaaggctttaaagtatgttcatt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34087686 |
taaaaagaatgatttattctcatgcaaatttcaaaggttttaaagtatgttcatt |
34087632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University