View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14262_high_8 (Length: 277)
Name: NF14262_high_8
Description: NF14262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14262_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 9 - 188
Target Start/End: Original strand, 4546950 - 4547129
Alignment:
| Q |
9 |
agagagatgaaagtgatgctgatgatattgaaactgctttgagagaagcaaaggaggagattggattagacccttctcttgttactgttgttactcttct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4546950 |
agagagatgaaagtgatgctgatgatattgaaactgctttgagagaagcaaaggaggagattggattagacccttctcttgttactgttgttactcttct |
4547049 |
T |
|
| Q |
109 |
cgaaccctttcatactaaggtgtactgttacttactttttattatctaccactaatctattaaatttgtccagtccaagt |
188 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4547050 |
cgaaccctttcatactaaggtctactgctacttactttttattatctaccactaatctattaaatttctccagtccaagt |
4547129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 220 - 250
Target Start/End: Original strand, 4547158 - 4547188
Alignment:
| Q |
220 |
gaccaaaccaacaaagggaaaacacattcga |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4547158 |
gaccaaaccaacaaagggaaaacacattcga |
4547188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University