View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14262_low_15 (Length: 242)
Name: NF14262_low_15
Description: NF14262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14262_low_15 |
 | |
|
| [»] scaffold0008 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 63 - 219
Target Start/End: Original strand, 10671111 - 10671266
Alignment:
| Q |
63 |
acatgacaatacttcacaacttttaccactagatcactattatatttgttaaaatcaacgtatcaaataagttgatgatggctgatgatttctttcaata |
162 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||||||| | ||| | |||| ||| || |||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
10671111 |
acatgacaatacttcacagcttttgcca-tagatcacaactatttatgttgaaagaaatgtatcaaataagttgatgatggttaatgatttctttcaata |
10671209 |
T |
|
| Q |
163 |
atttgatacttctcttactattggtgtaaatgaaacatctaatttacctttcaaatt |
219 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||| |||| | |||||||||||| |
|
|
| T |
10671210 |
atttgatgcttctattattattggtgtaaatgaaatgcctaactcacctttcaaatt |
10671266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 175
Target Start/End: Complemental strand, 48144 - 48109
Alignment:
| Q |
140 |
atggctgatgatttctttcaataatttgatacttct |
175 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48144 |
atggctaatgatttctttcaataatttgatacttct |
48109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University