View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14262_low_16 (Length: 216)
Name: NF14262_low_16
Description: NF14262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14262_low_16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 216
Target Start/End: Complemental strand, 4547569 - 4547370
Alignment:
| Q |
17 |
attatctggtattataaataaaaattgattggaaggatgaatagctgatgaagaatcttgaatttaaaggaagcagaatgattcacatttgacatttcta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4547569 |
attatctggtattataaataaaaattgattggaaggatgaatagctgatgaagaatcttgaatttaaaggaagcagaatgattcacatttgacatttcta |
4547470 |
T |
 |
| Q |
117 |
aaactaggcatggctccttagctcttaccccaaccctgttaaggttggaactcattggtaggaagtgtttggatcaacaagtaaattaagattccgaagc |
216 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4547469 |
aaactaggcacggctccttagctattaccccaaccctgttaaggttggaactcattggtaggaagtgtttggatcaacaagtaaattaagattcagaagc |
4547370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University