View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14262_low_8 (Length: 323)
Name: NF14262_low_8
Description: NF14262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14262_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 4547999 - 4548304
Alignment:
| Q |
1 |
tgatttcttgcattattgtctgtatgcagaatgataatagaagatctgaggaaggggaatggttgggagagaagcatcttgtacattattttgattatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4547999 |
tgatttcttgcattattgtctgtatgcagaatgataatagaagatctgaggaaagggaatggttgggagagaagcatcttgtacattattttgattatga |
4548098 |
T |
|
| Q |
101 |
ggtagagaacaaaaagtacgtgatatgggctataacggctgcaattttaattagggctgctacccttttgcttcggcggccgccagcttttctagagcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4548099 |
ggtagagaacaaaaagtacgtgatatgggctataacggctgcaattttaattagggctgctacccttttgcttcagcggccgccagcttttctagagcag |
4548198 |
T |
|
| Q |
201 |
aggcctaaaatatggggaggaattactgaaaatgacatgataatgctacagagaagtaatccacagctgtgattttatttacatctc-tttaagtttgca |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||| |||||||||||| |
|
|
| T |
4548199 |
aggcctaaaatatggggaggaattactgaaaatgacatgataatactacagagaagtaatccacaactgtgattttatttatatctcttttaagtttgca |
4548298 |
T |
|
| Q |
300 |
tatgct |
305 |
Q |
| |
|
|||||| |
|
|
| T |
4548299 |
tatgct |
4548304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 69 - 114
Target Start/End: Original strand, 4548399 - 4548444
Alignment:
| Q |
69 |
gagaagcatcttgtacattattttgattatgaggtagagaacaaaa |
114 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4548399 |
gagaagtatcttgtacattattttgattatgaggtagggaacaaaa |
4548444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University