View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14263_high_5 (Length: 401)
Name: NF14263_high_5
Description: NF14263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14263_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 38635135 - 38635365
Alignment:
| Q |
19 |
actccaaaataatttttgtgattcacaa-tttcattcataagacatcgcggaaaagagacccagttgcaacagtagtccgcagggataggagaactgtaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38635135 |
actccaaaataatttttgtgattcacaaatttcattcataagacatcgcggaaaagagacccagtagcaacagtagtccgcagggataggagaactgtaa |
38635234 |
T |
 |
| Q |
118 |
actctgaaacttgagaccatgtcttcaaccgcaaccgcaaccgcaaccgtcgtcataggccctttttcaacaacttcatcttcgaatcgcaatgctagaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38635235 |
actctgaaacttgagaccatgtcttcaactgcaaccgcaaccgcaaccgtcgtcataggccctttttcaacaacttcatcttcgaatcgcaatgctagaa |
38635334 |
T |
 |
| Q |
218 |
ccacattttccgccaattttacttctagaag |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
38635335 |
ccacatttgccgccaattttacttctagaag |
38635365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 313 - 385
Target Start/End: Original strand, 38635430 - 38635502
Alignment:
| Q |
313 |
aagcgatcctctactttccgtcgcatcaagcgtttttcccctgtcatggaatggcaggattgcaggtaactta |
385 |
Q |
| |
|
||||||||| | ||||||||||| ||||||| ||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
38635430 |
aagcgatccccaactttccgtcgattcaagcgattttcccctgtcatggagtggcaggattgcacgtaactta |
38635502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University