View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14263_low_7 (Length: 325)
Name: NF14263_low_7
Description: NF14263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14263_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 283
Target Start/End: Original strand, 1350614 - 1350875
Alignment:
| Q |
18 |
atcatcttcattcccgacctagcaatcaacacctctgcatttcataacgaccttcacccacttcaagcccccagccttttgccgtcgacgacatagacac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | | | || ||||||| |||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1350614 |
atcatcttcattcccgacctagcaatcaacacctctg---tccctcacaaccttcatccacgtcaagccc--agccttttgccgtcgacgacatagacac |
1350708 |
T |
 |
| Q |
118 |
cagtttgcgtcactcactcactttctatcatcgccatgttctcagaactgtctcaaaacactaggcatacaccctttgatttccgctatatcagaggttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1350709 |
cagtttgcgtcactcactcactttctatcatcgccatgttctcagaactgtctcaaaacactaggcatacaccctttgatttccgctatatcagaggttt |
1350808 |
T |
 |
| Q |
218 |
gtcatctagttgcaaccca-ccctattcattttactcattattatttgctttcgtcttgttgttgtt |
283 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1350809 |
gtcatctagttgcaacccacccctattcattttactcattattatttgctttcgtcttgttgttgtt |
1350875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University