View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14264_low_4 (Length: 251)
Name: NF14264_low_4
Description: NF14264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14264_low_4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 251
Target Start/End: Complemental strand, 41215742 - 41215502
Alignment:
| Q |
20 |
acgtgaacacaaccgatgcaaccatatctaagattgtgacgatgttgtgaaaac---------cttattttgcagctacaattgaagccatatccaaaac |
110 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41215742 |
acgtaaacacaaccgatccaaccatatctaagatcgtgacgatgttgtgaaaacatcctaaaccttattttgcagctacaattgaagccatagccaaaac |
41215643 |
T |
 |
| Q |
111 |
ttacttccctatatactagtaattgattgattaatatatccaatcaataaggtnnnnnnntgtgtaaaccaaccaaagaataagagaccgtctaaatgaa |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41215642 |
ttacttccctatatactaataattgattgattaatatatccaatcaataaggtaaaaaaatgtgtaaaccaaccaaagaataagagaccatctaaatgaa |
41215543 |
T |
 |
| Q |
211 |
agaccgcaccttctcaatccctagtagctttttgaatgtgg |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41215542 |
agaccgcatcttctcaatccctagtagctttttgaatgtgg |
41215502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University