View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14265_low_6 (Length: 365)

Name: NF14265_low_6
Description: NF14265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14265_low_6
NF14265_low_6
[»] chr3 (2 HSPs)
chr3 (155-347)||(1592709-1592910)
chr3 (267-347)||(6097887-6097967)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 9e-52; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 155 - 347
Target Start/End: Original strand, 1592709 - 1592910
Alignment:
155 ttcctttcgcgcagcccgacggcaaaattttcattatgattgg--att-----aatcaggactacacgtttagttattgcctttcatttaactttcttct 247  Q
    ||||||||||||||||||||||  |||||||||||||||||||  |||     | ||||||||||||| ||||||||  |||||||||  ||||||||||    
1592709 ttcctttcgcgcagcccgacggtgaaattttcattatgattggtgattggtatactcaggactacacggttagttatcacctttcattagactttcttct 1592808  T
248 ataaattttgaaaatgttgtg--tttttattgatatttaattgctattttgtatgtttgtttgataaatataggctctaagatcaacacttgatggtgga 345  Q
     |||||| |||| ||||||||  ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||    
1592809 gtaaattctgaagatgttgtgagtttttattgatatttgattgctattttgtatgtttttttgataaatataggctctaagatcaacacttgacggtgga 1592908  T
346 aa 347  Q
    ||    
1592909 aa 1592910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 267 - 347
Target Start/End: Complemental strand, 6097967 - 6097887
Alignment:
267 tgtttttattgatatttaattgctattttgtatgtttgtttgataaatataggctctaagatcaacacttgatggtggaaa 347  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
6097967 tgtttttattgatatttaattgctattttgtatgtttgtttgataaatataggctctaagatcaacatttgatggtggaaa 6097887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University