View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14265_low_6 (Length: 365)
Name: NF14265_low_6
Description: NF14265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14265_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 9e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 155 - 347
Target Start/End: Original strand, 1592709 - 1592910
Alignment:
| Q |
155 |
ttcctttcgcgcagcccgacggcaaaattttcattatgattgg--att-----aatcaggactacacgtttagttattgcctttcatttaactttcttct |
247 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||| | ||||||||||||| |||||||| ||||||||| |||||||||| |
|
|
| T |
1592709 |
ttcctttcgcgcagcccgacggtgaaattttcattatgattggtgattggtatactcaggactacacggttagttatcacctttcattagactttcttct |
1592808 |
T |
|
| Q |
248 |
ataaattttgaaaatgttgtg--tttttattgatatttaattgctattttgtatgtttgtttgataaatataggctctaagatcaacacttgatggtgga |
345 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1592809 |
gtaaattctgaagatgttgtgagtttttattgatatttgattgctattttgtatgtttttttgataaatataggctctaagatcaacacttgacggtgga |
1592908 |
T |
|
| Q |
346 |
aa |
347 |
Q |
| |
|
|| |
|
|
| T |
1592909 |
aa |
1592910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 267 - 347
Target Start/End: Complemental strand, 6097967 - 6097887
Alignment:
| Q |
267 |
tgtttttattgatatttaattgctattttgtatgtttgtttgataaatataggctctaagatcaacacttgatggtggaaa |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6097967 |
tgtttttattgatatttaattgctattttgtatgtttgtttgataaatataggctctaagatcaacatttgatggtggaaa |
6097887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University