View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14265_low_7 (Length: 364)
Name: NF14265_low_7
Description: NF14265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14265_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 6e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 19 - 132
Target Start/End: Original strand, 36023519 - 36023632
Alignment:
| Q |
19 |
aaccgaaaggtgtaaaaagtaacgcctccaaagcatacgtgtgaatgggtagttgtttggaacatgacttaggacggcccaattgttatcatattacttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36023519 |
aaccgaaaggtgtaaaaagtaacgcctgcaaagcatacgtgtgaatgggtagttgtttggaacatgacttaggacggcccaattgttatcatattacttt |
36023618 |
T |
|
| Q |
119 |
cctaatatcttttc |
132 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36023619 |
tctaatatcttttc |
36023632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 275 - 314
Target Start/End: Original strand, 36023766 - 36023805
Alignment:
| Q |
275 |
ttgtcataaatagttgttcgaacttcaaatatcagcactc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36023766 |
ttgtcataaatagttgttcgaacttcaaatatcagcactc |
36023805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University