View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14266_high_4 (Length: 298)
Name: NF14266_high_4
Description: NF14266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14266_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 37 - 284
Target Start/End: Original strand, 29005689 - 29005936
Alignment:
| Q |
37 |
tatgttgcctgggctggaacttttgtagaaccagcttgttaaagtttttaatttataagaagccacatacatggaccctcctccatctcttgcctgcaaa |
136 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29005689 |
tatgttggctgggctggaacttttgtggaaccagcttgttaaagattttcatttataagaagccacatacatggaccctcctccatatcttgcctgcaaa |
29005788 |
T |
|
| Q |
137 |
atgcctttaatttcaatttgaaaagtttagttctggacttctattttgaatattggcctaccatttctattttaacctaatcttgctacttttgtctctg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29005789 |
atgcctttaatttcaatttgaaaagtttagttctggacttctattttgaatattggcctaccatttctattttaacctaatattgctacttttgtctctg |
29005888 |
T |
|
| Q |
237 |
ctactaagaaaatcaccatgtgcccatgtcttccatgaagcaccaaat |
284 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29005889 |
ctactaagaaaatcaccatgtgcctatgtcttccatgaagcaccaaat |
29005936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University