View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14266_high_8 (Length: 231)
Name: NF14266_high_8
Description: NF14266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14266_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 13847833 - 13848038
Alignment:
| Q |
18 |
atgcttctaatctatcaaatat--gtctgtattgattgatgttgggtacttgcttcaaatgaggagagag------tctcttttatagtggaaaaaggaa |
109 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
13847833 |
atgcttctaatctatcaaatatatgtgtgtattgattgatgttgggtacttgcttcaaatgaggagagagccacattcccttttatagtggaaaaaggaa |
13847932 |
T |
|
| Q |
110 |
aaatagaaagattccccttagctattggtgtaaaacatttttatct-nnnnnnnnnnnnnnncatatgtaattaaacgaaaacaattcttatttaacgcg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13847933 |
aaatagaaagattccccttagctattggtgtaaaacatttttatctaaaaaaaaatcaaaaacatatgtaattaaacgaaaacacttcttatttaacgcg |
13848032 |
T |
|
| Q |
209 |
ataaaa |
214 |
Q |
| |
|
|||||| |
|
|
| T |
13848033 |
ataaaa |
13848038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University