View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14266_high_9 (Length: 218)
Name: NF14266_high_9
Description: NF14266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14266_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 21 - 204
Target Start/End: Complemental strand, 9948327 - 9948142
Alignment:
| Q |
21 |
aacctgagatcttgagaggactaactatcaattttatgtcattttactatcaacaaatttatcgttaacttaaccattcctttttgtcaaatttagccta |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9948327 |
aacctgagatcttgagaggactaactatcaattttatgtcattttactatcaacaaatttatcgttaacttaaccattcctttttgtcaaattgagccta |
9948228 |
T |
 |
| Q |
121 |
gtggactt-gagtagttat-gtctgagattgggaatatgcggacaggctaaagactaaagtggccgcaaagttggcaatgaaaatg |
204 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9948227 |
gtggacttggagtagttatggtctgagattgggaatatgcagacaggctaaagactaaagtggccgcaaagttggcaatgaaaatg |
9948142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University