View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_high_27 (Length: 342)
Name: NF14267_high_27
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 10 - 105
Target Start/End: Original strand, 26535698 - 26535793
Alignment:
| Q |
10 |
atgaaatgaaaacgcgaacagccaataagaagaacacaaaagcgtatatgtgtaggtcccattcgttcgatcccgattctccgattcatgtggctt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26535698 |
atgaaatgaaaacgcgaacagccaataagaagaacacaaaagcgtacatgtgtaggtcccattcgttcgatcccgattctccgattcatgtggctt |
26535793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 139 - 229
Target Start/End: Original strand, 26535827 - 26535917
Alignment:
| Q |
139 |
ttacacagtacttaaaatcaacggttagattcatttcaaccccgtgggaccacttttcactaacatccaaccgttgatttccgcagtaaca |
229 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26535827 |
ttacacagtacttaaaatcgacggttagattcatttcaaccccgtgggaccacttttcactaacatccaaccgttgatttccgcagtaaca |
26535917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University