View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_high_45 (Length: 270)
Name: NF14267_high_45
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 33016964 - 33017229
Alignment:
| Q |
1 |
ttgtagtaaatttcatcttattttgtttgtagtgtccattgtccactaaacatcgtagtaaataaaaagttgtctaacacgtaaaaggcatgttatgtgn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33016964 |
ttgtagtaaatttcatcttattttgtttatagtgtccattgtccactaaacatcgtagtaaataaaaagttgtctaacacataaaaggcatgttatgtgt |
33017063 |
T |
 |
| Q |
101 |
nnnnnnncttttagacaaaacatgttatgtggttttgtcttgtagttactattttgcaaat--aacgacgttaaatattttatctaatctgcatgtagga |
198 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33017064 |
ttttttcatttt-gacaaaacatgttatgtggttttgtcttgtagttactattttgcaaattaaacgacgttaaatattttatctaatctgcatgtagga |
33017162 |
T |
 |
| Q |
199 |
tatatctatacat-tttttgcagaatttatggattctataaaatctgtggaggcatgatgatgtcca |
264 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| | |||||||| |
|
|
| T |
33017163 |
tatatctatacatctttttgcagaatttatggattctataaaatctgtgggggcataaagatgtcca |
33017229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University