View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_high_52 (Length: 253)
Name: NF14267_high_52
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 27575075 - 27574905
Alignment:
| Q |
18 |
aaaagaagtaactttctagtcagtgaagaaaacaaatgttctttatatttttctttgaattaagcgttcttttgattttctcgaccaatccataaactag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27575075 |
aaaagaagtaactttctagtcagtgaagaaaacaaatgttctttatatttttctttcaattaaacgttcttttgattttctcgaccaatccataaactag |
27574976 |
T |
 |
| Q |
118 |
gccgggcagcaaactagtatgtctggatatgggaatgtgcaccttccatgtgttgaatgatatatagatag |
188 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27574975 |
gccgggcagcaaactagtatggctggatatgggaatgtgcaccttccatgtgttgaatgatatatagatag |
27574905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University