View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_high_53 (Length: 251)
Name: NF14267_high_53
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 2 - 117
Target Start/End: Complemental strand, 8370009 - 8369894
Alignment:
| Q |
2 |
tatcatttttggatatgttatgaatcatttttagaatttctaaataatattgatactattcaaattgaacaaaattttgctgttgaatgtctttatttga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8370009 |
tatcatttttggatatgttatgaatcatttttagaatttctaaataatattgatactattcaaattgaacaaaattttgctgttgaatgtctttatttga |
8369910 |
T |
 |
| Q |
102 |
atatgttaaagaagaa |
117 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8369909 |
atatgttaaagaagaa |
8369894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 33
Target Start/End: Original strand, 36344830 - 36344858
Alignment:
| Q |
5 |
catttttggatatgttatgaatcattttt |
33 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36344830 |
catttttggatatgttatgaatcattttt |
36344858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University