View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_low_12 (Length: 499)
Name: NF14267_low_12
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 18 - 483
Target Start/End: Complemental strand, 6968697 - 6968217
Alignment:
| Q |
18 |
gtgttggtgtcaaacaccgaacacaccttgaacttgaaggtttcacgctatatagattctaaccttggcaccccaaaatgttctattttaataaatatgc |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6968697 |
gtgttggtgtcaaacacagaacacaccttgaacttgaaggtttcgcgttatatagattctaaccttggcaccccaaaatgttctattttaataaatattc |
6968598 |
T |
 |
| Q |
118 |
atgattattttctgcggtgatctccacttgctatatcttcactataccagaaccgtgttcacctactgatagtgatatcagtaaataagtgtcttgaaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
6968597 |
atgattattttctgcggtgatctccacttgctatattttcactataccagaaccgtgttcacctactgatagtgataacagtaaattagtgtcttgaaat |
6968498 |
T |
 |
| Q |
218 |
tccaagatcagatcaaactttgtgtaatgtgcatggttgcaacgtcgttgctggtgaacataatctatgtagttcagatcaaaggtgtgtccaa------ |
311 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6968497 |
cccaagatcagatcaaactttgtgtagtgtgcatggttataaagtcattgctggtgaacataatctatgtagttcagatcaaaggtgtgtccaatgtcaa |
6968398 |
T |
 |
| Q |
312 |
---------tgtctgacacgactctgattttattactttctaaaattattatcactaactttgtgttagtatcaatgtcgtgtccgtatatgtgtcattg |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6968397 |
acgtgtcaatgtctgacacgactctgattttattactttctaaaattattatcactcactttgtgttagtatcaatgtcgtgtccgtatatgtgtcattg |
6968298 |
T |
 |
| Q |
403 |
attcatagagttgtgttacttttccttgctgacaccttgtaacatcagggaaatatctttattatctcattgaatgttcat |
483 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6968297 |
attcatagagttgtgttacttttccttgctgacaccttgtaacatcagggaaatatctttattatctcattgaatgttcat |
6968217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University