View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_low_29 (Length: 354)
Name: NF14267_low_29
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 42 - 193
Target Start/End: Original strand, 4057176 - 4057329
Alignment:
| Q |
42 |
aatgtgtatatccttaggtcaccaaaaaccgccatgattcgctaat-aaattgataatctctcttagtgatt-aaaaaagttcaaagttttgaattgttt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4057176 |
aatgtgtatatccttaggtcaccaaaaaccgccatgattcgctaaacaaattgataatctctcttagtgatttaaaaaagttcaaagttttgaattgttt |
4057275 |
T |
 |
| Q |
140 |
ctctgagtcattttgttgctttcttagcaaatttatctgccctctattgcttct |
193 |
Q |
| |
|
|||| ||||||||| |||||| |||||||||||||||| |||||| || ||||| |
|
|
| T |
4057276 |
ctctaagtcattttattgcttgcttagcaaatttatcttccctcttttacttct |
4057329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 209 - 336
Target Start/End: Original strand, 4058354 - 4058481
Alignment:
| Q |
209 |
tgaagacgcaacactatgctctcatataagagatacacattcaagttctaataaactcacacaacttattacaagatcaatttaggtgactagttaaggc |
308 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4058354 |
tgaagaggcaacactatgctctcgtataagagatacacatacaagttctaataaactcacacaacttattccaagatcaatttaggtgactagttaaggc |
4058453 |
T |
 |
| Q |
309 |
agaagtaggtgacacaataacttataat |
336 |
Q |
| |
|
||||| |||||||||| ||||||||||| |
|
|
| T |
4058454 |
agaagcaggtgacacagtaacttataat |
4058481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University