View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_low_37 (Length: 327)
Name: NF14267_low_37
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 87 - 314
Target Start/End: Original strand, 52807994 - 52808221
Alignment:
| Q |
87 |
ataataataatgtgagaaggatgtttgattggtgttagagcataagacaaacaaatacttgcatgattggtttatggatgaaacctggcaattatggtat |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52807994 |
ataataataatgtgagaaggatgtttgattggtgttagagcataagacaaacaaatacttgcatgattggtctatggatgaaacctggcaattatggtat |
52808093 |
T |
|
| Q |
187 |
tttgctgtggtgcgaattggtaattaatcaccttattaactatgtttggctgtactaataaacaactctatcggttagttaagaaactaaactaccagtt |
286 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52808094 |
tttgttgtggtgcgaattggtaattaatcaccttattaactatgtttggctgtactaataaacaactctatcggttagttaagaaactaaactaccagtt |
52808193 |
T |
|
| Q |
287 |
acaaacaaagtttaagttacagcctatg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
52808194 |
acaaacaaagtttaagttacagcctatg |
52808221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University