View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_low_42 (Length: 301)
Name: NF14267_low_42
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 3 - 284
Target Start/End: Original strand, 46678170 - 46678448
Alignment:
| Q |
3 |
aaggtcaatttagagaatggtatgtttgagtctattgaaaatggggagaccaaccaagaagctctcaaaaggtatattatggtcattcaatgattatatt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46678170 |
aaggtcaatttagagaatggtatgtttgagcctattgaaaatggggagaccaaccaagaagctctcaaaaggtatattatggtcattcaatgattatatt |
46678269 |
T |
 |
| Q |
103 |
tatggtcagcaacaattgtaaaacttttcctcnnnnnnnnnnnntgtagaaattttttatatatgtattttcatgagctaaatatcaacattaatgcatg |
202 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46678270 |
tatggtcaacaaaaattgtaaaacttttcctcaaaaaaaaa---tgtagaaattttttatatatgtattttcatgagctaaatatcaacattaatgcatg |
46678366 |
T |
 |
| Q |
203 |
caggtttgcaaaaatactatcacaagagaggaagcttcgagaattgacatcccctcacactaacaacaccttgatatagaga |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46678367 |
caggtttgcaaaaatactatcacaagagaggaagcttcgagaattgacatcccctcacactaacaacaccttgatatagaga |
46678448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 3 - 76
Target Start/End: Original strand, 46682161 - 46682234
Alignment:
| Q |
3 |
aaggtcaatttagagaatggtatgtttgagtctattgaaaatggggagaccaaccaagaagctctcaaaaggta |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||| || || |||||| |||| || ||||||||||| |
|
|
| T |
46682161 |
aaggtcaatttagagaatggtatgtttgagcctatggaaaagggagaaaccaacgaagatgccctcaaaaggta |
46682234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 203 - 265
Target Start/End: Original strand, 46682313 - 46682375
Alignment:
| Q |
203 |
caggtttgcaaaaatactatcacaagagaggaagcttcgagaattgacatcccctcacactaa |
265 |
Q |
| |
|
||||||||| |||||||| || |||||||||| ||| ||||| |||| ||||||||||||||| |
|
|
| T |
46682313 |
caggtttgccaaaatactttctcaagagaggaggctccgagagttgaaatcccctcacactaa |
46682375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 262
Target Start/End: Complemental strand, 46655425 - 46655364
Alignment:
| Q |
201 |
tgcaggtttgcaaaaatactatcacaagagaggaagcttcgagaattgacatcccctcacac |
262 |
Q |
| |
|
||||||||||| |||||||| || |||||||||| ||| ||||| |||| |||||||||||| |
|
|
| T |
46655425 |
tgcaggtttgccaaaatactttctcaagagaggaggctacgagagttgaaatcccctcacac |
46655364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University