View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_low_46 (Length: 283)
Name: NF14267_low_46
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 13 - 268
Target Start/End: Complemental strand, 43323549 - 43323294
Alignment:
| Q |
13 |
gcataggagggtggtcttttattttgctactgtttgttcttaatatgtatagaacacaagtatttactattgtgacgtgtcaaaacaacgttggttatat |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
43323549 |
gcataggagggtggtcttttatttttctactgtttgttcttaatatgtatagaacacaagtatttactattgtgacttgtcaaaacaatgttggttatat |
43323450 |
T |
 |
| Q |
113 |
aagtagttgagattccaattttagtttgttgtgtctttcatcattttggatggtaaagtattcatccagcaaatatatctctttcttttaatagttgtcg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43323449 |
aagtagttgagattccaattttagtttgttgtgtctttcatcattttggatggtaaagtattcatccagcaaatatatctctttcttttaatagttgtcg |
43323350 |
T |
 |
| Q |
213 |
cagtaatggttatgttcacgtcacaatcctttatatgacaatatgacagagaattg |
268 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43323349 |
cagtaatggttatgttcgcgtcacaatcctttatatgacaatatgacagagaattg |
43323294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University