View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_low_48 (Length: 275)
Name: NF14267_low_48
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_low_48 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 218993 - 219242
Alignment:
| Q |
1 |
attctgataaaatattcatttttagttgccagccaaataatgaactactttatgaggttgcaaagaatcaagataattcttatgaacaaaagtagaggaa |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
218993 |
attctgataaaatattcagttttagttgccagccaaataatgaactactttatgaggctgcaaagaatcaagataattcttttgaacaaaagaagaggaa |
219092 |
T |
 |
| Q |
101 |
aattgttcatagagagattgaaaggcaaaggagacaagaaatggctacctattatgcatctctccgatctttgcttcctcttgagttcatcaaggtgaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
219093 |
aattgttcatagagagattgaaaggcaaaggagacaagaaatggctacctattatgcatctctccgatctttgcttcctcttgagttcatcaaggtgaga |
219192 |
T |
 |
| Q |
201 |
aatttatatatgttttttcatagagaattctttgaaggt-atatatactt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
219193 |
aatttatatatgttttttcatagagaattctttgaaggtaatatatactt |
219242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 98 - 149
Target Start/End: Complemental strand, 46230452 - 46230401
Alignment:
| Q |
98 |
gaaaattgttcatagagagattgaaaggcaaaggagacaagaaatggctacc |
149 |
Q |
| |
|
|||||| |||||||| || ||||| | ||||||||||||||||||||||||| |
|
|
| T |
46230452 |
gaaaatggttcatagggaaattgagaagcaaaggagacaagaaatggctacc |
46230401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University