View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14267_low_55 (Length: 258)

Name: NF14267_low_55
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14267_low_55
NF14267_low_55
[»] chr1 (1 HSPs)
chr1 (9-240)||(26278641-26278872)


Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 9 - 240
Target Start/End: Complemental strand, 26278872 - 26278641
Alignment:
9 agcaaaggtcgggttatgggcttcaaagccaactgtatatctgcccctttgtatcaggaaaattgttcttctaactttagaattgcattaacaccccaaa 108  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26278872 agcaaaggtcgggctatgggcttcaaagccaactgtatatctgcccctttgtatcaggaaaattgttcttctaactttagaattgcattaacaccccaaa 26278773  T
109 attacctaattgaactcaacggcagttaactattgctcaccccaaacgacggttaattgccgcagcgttctggtttattccagaatagcaacaatcgttt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||  ||||     
26278772 attacctaattgaactcaacggcagttaactattgctcaccccaaacgacggttaattgccgcagcgttttggtttattccagaatagcaacagccgtta 26278673  T
209 actgattctttcaaaacacaacttcaatcaaa 240  Q
    ||||||||||||||||||| ||||||||||||    
26278672 actgattctttcaaaacactacttcaatcaaa 26278641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University