View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_low_55 (Length: 258)
Name: NF14267_low_55
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_low_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 9 - 240
Target Start/End: Complemental strand, 26278872 - 26278641
Alignment:
| Q |
9 |
agcaaaggtcgggttatgggcttcaaagccaactgtatatctgcccctttgtatcaggaaaattgttcttctaactttagaattgcattaacaccccaaa |
108 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26278872 |
agcaaaggtcgggctatgggcttcaaagccaactgtatatctgcccctttgtatcaggaaaattgttcttctaactttagaattgcattaacaccccaaa |
26278773 |
T |
 |
| Q |
109 |
attacctaattgaactcaacggcagttaactattgctcaccccaaacgacggttaattgccgcagcgttctggtttattccagaatagcaacaatcgttt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
26278772 |
attacctaattgaactcaacggcagttaactattgctcaccccaaacgacggttaattgccgcagcgttttggtttattccagaatagcaacagccgtta |
26278673 |
T |
 |
| Q |
209 |
actgattctttcaaaacacaacttcaatcaaa |
240 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |
|
|
| T |
26278672 |
actgattctttcaaaacactacttcaatcaaa |
26278641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University