View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_low_60 (Length: 250)
Name: NF14267_low_60
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_low_60 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 41431486 - 41431290
Alignment:
| Q |
19 |
ttactaacagaaaccgatcacaaaaagagacttttctagatatttttggtttggttatagtctaacctggatgactgctttatattgtcatcagtcaact |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41431486 |
ttactaacagaaaccgatcacaaaaagagacttttctagatatgtttggtttggttatagtctaacctggatgactgctttatattgtcatcagtcaact |
41431387 |
T |
|
| Q |
119 |
gattttgcaagtgattattattattatcttgttgaaacttgagaaggacgtcaagtagatcttcttcttcgtgactgtttttatgatcattgatgatgtc |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41431386 |
gattttgcaagtgattatta---ttatcttgttgaaacttgagaaggacgtcaagtagatcttcttcttcgtgactgtttttatgatcattgatgatgtc |
41431290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University