View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_low_66 (Length: 238)
Name: NF14267_low_66
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_low_66 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 36941125 - 36941331
Alignment:
| Q |
1 |
taatactaatagccccaacaagttggaagtttgtaatacaagaaaaatacaatttgtaattgcattgactgaacaagaaaaattgatgaagaaggtggta |
100 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36941125 |
taattctaacagccccaacaagttggaagtttgtattactagaaaaatacaatttgtaatcgcactgactgaacaagaaaaattgatgaagaaggtggta |
36941224 |
T |
 |
| Q |
101 |
gtggtcgagatgcataattgataattcctatagtgttctttgttcttcgactaattctctccataattccagcgtttccacgatatccactccaatagaa |
200 |
Q |
| |
|
||||| ||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||| |
|
|
| T |
36941225 |
gtggtagagatgc-------ataattcctata--gttctttgttcttcgactaattctctccatacttccagcgtttccacgatttccattccaatagaa |
36941315 |
T |
 |
| Q |
201 |
tcaagaactttgatag |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36941316 |
tcaagaactttgatag |
36941331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University