View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_low_70 (Length: 233)
Name: NF14267_low_70
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_low_70 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 16 - 80
Target Start/End: Original strand, 30112332 - 30112396
Alignment:
| Q |
16 |
caaaggttaactgattttacttgacatagtttcaatttggaattggtaaactgatctaaaagtag |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30112332 |
caaaggttaactgattttacttgacatagtttcaatttggaattggtaaaatgatctaaaagtag |
30112396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 124 - 217
Target Start/End: Complemental strand, 35811085 - 35810995
Alignment:
| Q |
124 |
cagagctgcaaacatcgcatttataaaggagtcagatcaaaatcagaatagtctcgaagccaacaggccgaatcaaagaacaattagcagtttc |
217 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||||||||||||||||||||| ||| ||||||||||||| |||||| ||||||||||||| |
|
|
| T |
35811085 |
cagagctgcaaacaacgcatatat---ggagtcagatcaaaatcagaatagtctcaaaggcaacaggccgaataaaagaaaaattagcagtttc |
35810995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University