View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_low_71 (Length: 232)
Name: NF14267_low_71
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_low_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 3361640 - 3361442
Alignment:
| Q |
19 |
cataggactgactaattcgaggagataaatcccaccgtgtatgttgataatttactgtagctttctgttgagttttgcagatgagattgaagaacatgcc |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3361640 |
cataggactgactaattcgaggagacaaattcaaccgtctatgttgataatttactgtagctttctgttgagttttgcagatgagattgaagaacatgcc |
3361541 |
T |
|
| Q |
119 |
ttgaatgtggaatcatgtgttcaagttttgagaattttgaacaccaaggcagatgttgaaattgagaaactcgaaaatgatctcttgtgccttgagaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3361540 |
ttgaatgtggaatcatgtgttcaagttttgagaattttgaacaccaaggcagatgttgaaattgagaaactcgaaaatgatctcttgtgccttgagaat |
3361442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University