View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14267_low_78 (Length: 208)
Name: NF14267_low_78
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14267_low_78 |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0085 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 13 - 190
Target Start/End: Complemental strand, 33630 - 33452
Alignment:
| Q |
13 |
agcataggaccaccacaaacccttttttcattgctttattatatataatcatcacctcatgttgaaactatattgcatttgcataccaaaaaagtgatac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33630 |
agcataggaccaccacaaacccttttttcattgctttattatatataatcatcacctcatgttgaaactatattgcatttgcataccaaaaaagtgatac |
33531 |
T |
 |
| Q |
113 |
a-nnnnnnnngtgttagaaagtttaaagagagaaacataaatggcttataaagtacacaacatggagcaaagaggaaac |
190 |
Q |
| |
|
| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33530 |
atttttttttgtgttagaaagcttaaagagagaaacataaatggcttataaagtacacaacatggagcaaagaggaaac |
33452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University