View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14269_high_32 (Length: 248)
Name: NF14269_high_32
Description: NF14269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14269_high_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 121 - 233
Target Start/End: Complemental strand, 41242905 - 41242793
Alignment:
| Q |
121 |
ggatctaggttggcaaacttagaaacgtatgaatgcatgaggataatggtcattcaattgaggagatggtgcacatgtagacatcctaacaatcaaatca |
220 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
41242905 |
ggatctaggttggcaaccttagaaacgtatgaatgcatgaggataacggtcattcaattgaggagatggtgcacatgtagacatcctaccaatcaagtca |
41242806 |
T |
 |
| Q |
221 |
tttaagagatatg |
233 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41242805 |
tttaagagatatg |
41242793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 41242975 - 41242907
Alignment:
| Q |
1 |
ttggctttcgcaaatttctattttcttcatgaaatcaaacacgcaagtgcacaatataaattacaatta |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41242975 |
ttggctttcgcaaatttctattttcttcataaaatcaaacacgcaagtgcacaatataaattataatta |
41242907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University