View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14269_high_34 (Length: 230)
Name: NF14269_high_34
Description: NF14269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14269_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 214
Target Start/End: Original strand, 3049375 - 3049572
Alignment:
| Q |
17 |
atcaagaagattcaattccagaatctaagcaacaaaatgaagaaagaaagtcaaagggtgttaggatatggaagtgtttttgtattccaagtgaatggtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3049375 |
atcaagaagattcaattccagaatctaagcaacaaaatgaagaaagaaagtcaaagggtgttaggatatggaagtgtttttgtattccaagtgaatggtt |
3049474 |
T |
 |
| Q |
117 |
taaaatgctatcaagagaaatgcattggagttttgtttttggagttgttgttgtttatggaataagtcaaggtttaggtggtgctcttgctggtgttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3049475 |
taaaatgctatcaagagaaatgcattggagttttgtttttggagttgttgttgtttatggaataagtcaaggtttaggtggtgctcttgctggtgttg |
3049572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University