View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14269_high_37 (Length: 208)
Name: NF14269_high_37
Description: NF14269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14269_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 8e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 33815229 - 33815051
Alignment:
| Q |
17 |
ataatcattattatttatcatgttttggtatatgcagcttgcacctgtgatggaacaatttatggggcgctactggctgtgactggacttgcatgtttat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33815229 |
ataatcattattatttatcatgttttggtatatgcagcttgcacctgtgatggaacaatttatggggcgctactggctgtgactggacttgcatgtttat |
33815130 |
T |
|
| Q |
117 |
attcatgttattatcggtccaaactgagggcacaatatgacttgccagaggcaccttgtatggattgcttagttcattt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33815129 |
attcatgttattatcggtccaaactgagggcacaatatgacttgccagaggcaccttgtatggattgcttagttcattt |
33815051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 40 - 195
Target Start/End: Complemental strand, 33810297 - 33810142
Alignment:
| Q |
40 |
tttggtatatgcagcttgcacctgtgatggaacaatttatggggcgctactggctgtgactggacttgcatgtttatattcatgttattatcggtccaaa |
139 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33810297 |
tttggtatatgcagcttgcacatgtgatggaacaatttatggggcgctactggctgtgactggacttgcatgtttatattcatgttattatcggtccaaa |
33810198 |
T |
|
| Q |
140 |
ctgagggcacaatatgacttgccagaggcaccttgtatggattgcttagttcattt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33810197 |
ctgagggcacaatatgacttgccagaggcaccttgtatggattgcttagttcattt |
33810142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University