View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14269_high_8 (Length: 565)

Name: NF14269_high_8
Description: NF14269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14269_high_8
NF14269_high_8
[»] chr4 (1 HSPs)
chr4 (223-265)||(36941017-36941059)


Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 223 - 265
Target Start/End: Complemental strand, 36941059 - 36941017
Alignment:
223 cattttttatgtcaaatatttttcatttgtttattccaattga 265  Q
    ||||||||||||||||||||||||||||||| |||| ||||||    
36941059 cattttttatgtcaaatatttttcatttgttcattcaaattga 36941017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University