View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14269_low_16 (Length: 397)
Name: NF14269_low_16
Description: NF14269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14269_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 386
Target Start/End: Original strand, 41612121 - 41612495
Alignment:
| Q |
19 |
aagagaatgaagagaggataggtttaaaaaagatatccatcctcttttgttaatttattttggaagaagnnnnnnnnnnnnn-ggtgaaaatggtgggga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41612121 |
aagagaatgaagagaggataggtttaaaaaagatatccatcctcttttgttaatttattttggaagaagaaaaaaaaaaaaaaggtgaaaatggtgggga |
41612220 |
T |
 |
| Q |
118 |
tgatgaattcaagaatgatggaagatgtggttgtaattggagggttgatcggtgtacaatttgtttatgctggaaatgctatgctcttgaagtatcttat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41612221 |
tgatgaattcaagaatgatggaagatgtggttgtaattggcgggttgattggtgtacaatttgtttatgctggaaatgctatgctcttgaagtatcttat |
41612320 |
T |
 |
| Q |
218 |
gtctttaggtctccaatcttttaccattgtcatttacacttcttttgctacatttcttcttctcctaccctttgtcttgtattttgaaaggtattttctc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41612321 |
gtctttaggtctccaatcttttaccattgtcatttacacttcttttgctacatttcttcttctcctaccctttgtcttgtattttgaaaggtattttctc |
41612420 |
T |
 |
| Q |
318 |
tcttcnnnnnnnnagtttctattgttgttattttgaga------tatggaggatttttgaactttgatgatgatg |
386 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41612421 |
tcttctttttgttagtttctattgttgttattttgagatggggttatggaggatttttgaactttgatgatgatg |
41612495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University