View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14269_low_27 (Length: 329)
Name: NF14269_low_27
Description: NF14269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14269_low_27 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 329
Target Start/End: Original strand, 14206855 - 14207167
Alignment:
| Q |
18 |
gattttgcgttgttctggttaatagtat-aggttattacttttacctgaatgctgcttgctgatgagctagagattaggtataagaaatcttctaccact |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14206855 |
gattttgcgttgttctagttaatagtattaggttattacttttacctgaatgctgcttgctgatgagctagagattaggtataagaaatcttctaccact |
14206954 |
T |
 |
| Q |
117 |
tccatggctaccacattatctcctttgtcagtaaggattgaaattttgggttttgcacttcttttccattcctatatcataatccatccatgtaaggaca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14206955 |
tccatggctaccacattatctcctttgtcagtaaggattgaaattttgggttttgcacttcttttccattcctatatcataattcatccatgtaaggaca |
14207054 |
T |
 |
| Q |
217 |
aaacaaagcnnnnnnnnaagctcaaaagttttagttcttaccttgaaggttgttccttcaacatgcttacttgcactatagagccaatctctataggcta |
316 |
Q |
| |
|
| ||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14207055 |
acacaaagcttttttttaagctcaaaagttttagttctcaccttgaatgttgttccttcaacatgcttacttgcactatagagccaatctctataggcta |
14207154 |
T |
 |
| Q |
317 |
caattgaattgat |
329 |
Q |
| |
|
||||||||||||| |
|
|
| T |
14207155 |
caattgaattgat |
14207167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University