View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14269_low_29 (Length: 287)
Name: NF14269_low_29
Description: NF14269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14269_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 12 - 163
Target Start/End: Original strand, 8344422 - 8344573
Alignment:
| Q |
12 |
tcatcatttgcatagctatggtggtggtattggcattaatagtggtggaggatacggcaatggtgcagttggtggttcaggtagtggtggagttggtgta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8344422 |
tcatcatttgcatagctatggtggtggtattggcattaatagtggtggaggatacggcaatggtgcagttggtggttcaggtagtggtggagttggtgta |
8344521 |
T |
|
| Q |
112 |
ggacctggttctgggggtgtagttggaggtgaaaataaccccggaaatagtc |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
8344522 |
ggacctggttctgggggtgtagttggaggtggatataaccccggaaatagtc |
8344573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University