View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14269_low_29 (Length: 287)

Name: NF14269_low_29
Description: NF14269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14269_low_29
NF14269_low_29
[»] chr2 (1 HSPs)
chr2 (12-163)||(8344422-8344573)


Alignment Details
Target: chr2 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 12 - 163
Target Start/End: Original strand, 8344422 - 8344573
Alignment:
12 tcatcatttgcatagctatggtggtggtattggcattaatagtggtggaggatacggcaatggtgcagttggtggttcaggtagtggtggagttggtgta 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8344422 tcatcatttgcatagctatggtggtggtattggcattaatagtggtggaggatacggcaatggtgcagttggtggttcaggtagtggtggagttggtgta 8344521  T
112 ggacctggttctgggggtgtagttggaggtgaaaataaccccggaaatagtc 163  Q
    ||||||||||||||||||||||||||||||| | ||||||||||||||||||    
8344522 ggacctggttctgggggtgtagttggaggtggatataaccccggaaatagtc 8344573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University