View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14269_low_30 (Length: 286)
Name: NF14269_low_30
Description: NF14269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14269_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 124 - 276
Target Start/End: Complemental strand, 37176738 - 37176586
Alignment:
| Q |
124 |
gcagccgaacgaaacatcacgttcttgaaaagtgtcgcagattctcaatggcttcaccatacaaacgttacagttgaagcaatacgaaggtaccgtgatt |
223 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37176738 |
gcagccaaacgtaacatcacgttcttgaaaagtgttgcagattctcaatggcttcaccatacaaacattacagttgaagcaatacgaaggtaccgtgatt |
37176639 |
T |
 |
| Q |
224 |
tatggatgccgttgatctctgatctaacactatcaaactcttctcttcctatg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37176638 |
tatggatgccgttgatctctgatctaacactatcaaactcttctcttcctatg |
37176586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 7 - 134
Target Start/End: Complemental strand, 50538339 - 50538212
Alignment:
| Q |
7 |
acctgttcttggaaaccagaaggatcagacatgatcccaaggttagcagcacgcaatagaaccggggataggtgggtgtgttggccttcatagctggtta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
50538339 |
acctgttcttggaaaccagaaggatcagacatgatcccaaggttagcagcacgcaatagaaccggggataggtggatgtgatggccttcatagctggtta |
50538240 |
T |
 |
| Q |
107 |
gcacgatcgaagagtctgcagccgaacg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
50538239 |
gcacgatcgaagagtctgcagccgaacg |
50538212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University