View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14269_low_38 (Length: 216)
Name: NF14269_low_38
Description: NF14269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14269_low_38 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 36916227 - 36916013
Alignment:
| Q |
1 |
aacgagggttgttcttatttaagcaactatggtgacaaatgcaatcgtgcatgcaaagctgagnnnnnnnnnnnnnnnnacaaatgtgaacaaattatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
36916227 |
aacgagggttgttcttatttaagcaactatggtgacaaatgcaatcgtgcatgcaaagctgagttttttttttttttt-acaaatatgaacaaattatca |
36916129 |
T |
 |
| Q |
101 |
tttttctttacattttttataagcaaatttaacagtccaataatctttaatagaaaatgaggtaaagttatagtggccctagactagtacatacgtgatc |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36916128 |
tttttctttgcattttttataagcaaatttaacagtccaataatctttaatagaaaatgaggtaaagttatagtggccctagactagtacatacgtgatc |
36916029 |
T |
 |
| Q |
201 |
attccattttatgctt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36916028 |
attccattttatgctt |
36916013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University