View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14271_high_14 (Length: 358)
Name: NF14271_high_14
Description: NF14271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14271_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 9 - 343
Target Start/End: Original strand, 42560934 - 42561268
Alignment:
| Q |
9 |
cagacggtggtggattcattctgggaggagaaagcaacatcccctcagccatttctaccatcaatcttggcattgagaatatagcttcttcatcaagaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42560934 |
cagacggtggtggattcattctgggaggagaaagcaacataccctcagccatttctaccatcaatcttggcattgagaatatagcttcttcatcaagaaa |
42561033 |
T |
 |
| Q |
109 |
ctcagtttcataccaaggcctagcattaaagccagcatcattattaacggtttcagccgccgttaactcggctgcagcagtggcagcactgcggatatca |
208 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
42561034 |
ctcagtttcataccaaggcctaccatttaagccagcatcattattaacggcttcagccgccgttaactcagctgcagctgtggcagcactgcggatatca |
42561133 |
T |
 |
| Q |
209 |
tcgggtgaattggaggcaggcaccgggtacttgctagctgaattagggaagtttagaacagcgtccccgcctttgagagccaaagccgcgacatcataag |
308 |
Q |
| |
|
|| |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
42561134 |
tctggtgaattagacgcaggcaccgggtacttgctagctgaattagggaagtttagaacagcatccccgcctttgagggccaaagtcgcgacatcataag |
42561233 |
T |
 |
| Q |
309 |
ccgtggctgccatctcaggggtagggaatgtgcct |
343 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42561234 |
ccgcggctgccatctcaggggtagggaatgtgcct |
42561268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University