View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14271_high_17 (Length: 337)
Name: NF14271_high_17
Description: NF14271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14271_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 14 - 326
Target Start/End: Complemental strand, 42285883 - 42285571
Alignment:
| Q |
14 |
atgaagagacgaggagaagaaaacaatatacctagctatttatcttctggctattgttttcttgtgtgtaaaatttagctaccctctcttgttatattcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42285883 |
atgaagagacgaggagaagaaaacaatatacctagctatttatcttctggctattgttttcttgtgtgtaaaatttagctaccctctcttgttatattcc |
42285784 |
T |
|
| Q |
114 |
tcaatcattttgtgtcatatgaatatttaaataatttattttgctactttacatgcatgcttgtccacccgtatgcatatataacaatatctctttctat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42285783 |
tcaatcattttgtgtcatatgaatatttaaataatttattttgctactttacatgcatgcttgtccacccgtatgcatatataacaatatctctttctat |
42285684 |
T |
|
| Q |
214 |
gtgtgttttctttcatttaatttgtattgaaaaattaattatgtgtggtaaaatttaaaagtttgcttgctagcaaagagtgatgaattggagggtaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42285683 |
gtgtgttttctttcatttaatttgtattggaaaattaattatgtgtggtaaaatttaaaagttttcttgctagcaaagagtgatgaattggagggtaaaa |
42285584 |
T |
|
| Q |
314 |
tatgtcactattg |
326 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42285583 |
tatgtcactattg |
42285571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University