View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14271_high_29 (Length: 236)
Name: NF14271_high_29
Description: NF14271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14271_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 37 - 219
Target Start/End: Original strand, 16814480 - 16814661
Alignment:
| Q |
37 |
ttatatgctaatgtcaatttcaaccatttcaataacgcgttttatatgctctcattattgaacatattatataccatcttgttctttttctatagttcct |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16814480 |
ttatatgctaatgtcaatttcaaccatttcaataacgcgttttatatgctctcattattgaacatattatataccatcttgttctttttctatagttcc- |
16814578 |
T |
|
| Q |
137 |
ttgtctttgcacattttctaagtcttcaaaaatattccattttttcatcaccatgggatatggaacaagaaaactctcagatg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16814579 |
ttgtctttgcacattttctaagtcttcaaaaatattccattttttcatcaccatgggatatggaacaagaaaactctcagatg |
16814661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University