View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14271_high_37 (Length: 210)
Name: NF14271_high_37
Description: NF14271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14271_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 38 - 193
Target Start/End: Original strand, 6139090 - 6139245
Alignment:
| Q |
38 |
aaaattgaagaggctaccaagagttaaaatcagtactgaactttcaagaactgtcttcatctctctagaacctggatgtaaatgcaaacaactagataaa |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6139090 |
aaaattgaagaggctaccaagagttaaaatcagtactgaactttcaagaactgtcttcatctctctagaacctggatgtaaatgcaaacaactagataaa |
6139189 |
T |
|
| Q |
138 |
tgattgcaagaaagaaaaggcattgactagtgaaatattatacacggttggaatta |
193 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6139190 |
tgattgaaagaaagaaaaggcattgactagtgaaatattatacacggttggaatta |
6139245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University